Journal: Antioxidants

Article Title: Saposhnikovia divaricata Inhibits Inflammation, Oxidative Stress, and Ferroptosis to Alleviate DSS-Induced Ulcerative Colitis

doi: 10.3390/antiox15020258

Figure Lengend Snippet: Network pharmacology analysis identifies p53 as a core ferroptosis-related target of FF in UC. ( A ) Venn diagram illustrating the intersection of FF compound targets with ferroptosis- and UC-related targets. ( B ) Protein–protein interaction (PPI) network of the common targets. Node size and color intensity represent the degree of connectivity, with TP53 (p53) identified as the core target. ( C ) Compound-target-pathway network diagram. The inner pink nodes represent the 38 intersecting targets linking FF, UC, and ferroptosis. ( D ) Gene Ontology (GO) enrichment analysis of the common targets, categorized into Biological Process (BP, red), Cellular Component (CC, green), and Molecular Function (MF, blue). ( E ) Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.

Article Snippet: The p53 antibody was obtained from Boster Biological Technology Co., Ltd. (Pleasanton, CA, USA, Item #BM0101).

Techniques:

Journal: Antioxidants

Article Title: Saposhnikovia divaricata Inhibits Inflammation, Oxidative Stress, and Ferroptosis to Alleviate DSS-Induced Ulcerative Colitis

doi: 10.3390/antiox15020258

Figure Lengend Snippet: FF modulates the expression of ferroptosis-related proteins in colon tissue via the p53 pathway. ( A ) Representative immunohistochemical (IHC) images of p53, SLC7A11, and GPX4 expression in colon sections (scale bar = 50 μm). ( B – D ) Quantitative analysis of the relative protein expression levels of p53 (B), SLC7A11 (C), and GPX4 (D). Data are presented as the mean ± SD ( n = 3 independent experiments). ### p < 0.001 versus the control (CON) group; * p < 0.05, ** p < 0.01, *** p < 0.001 versus the DSS model group.

Article Snippet: The p53 antibody was obtained from Boster Biological Technology Co., Ltd. (Pleasanton, CA, USA, Item #BM0101).

Techniques: Expressing, Immunohistochemical staining, Control

Journal: iScience

Article Title: Tumor-suppressive role of the musculoaponeurotic fibrosarcoma gene in colorectal cancer

doi: 10.1016/j.isci.2023.106478

Figure Lengend Snippet: Inverse relationship between c-MAF and p53 protein expression

Article Snippet: . pCMV6-c-MAF plasmid DNA was purchased from OriGene (Rockville, MD, USA). pCMV6-empty vector was used as a control. pCMV-Neo-Bam p53 R175H (R175H), pCMV-Neo-Bam p53 R248W (R248W), and pCMV-Neo-Bam (Empty) were purchased from Addgene ( a gift from Bert Vogelstein, addgene, #16436; http://n2t.net/addgene:16436 ; RRID:Addgene_16436, #16437; http://n2t.net/addgene:16437 ; RRID:Addgene_16437, #16440; http://n2t.net/addgene:16440 ; RRID:Addgene_16440, respectively).

Techniques: Expressing

Journal: iScience

Article Title: Tumor-suppressive role of the musculoaponeurotic fibrosarcoma gene in colorectal cancer

doi: 10.1016/j.isci.2023.106478

Figure Lengend Snippet: Key resources table

Article Snippet: . pCMV6-c-MAF plasmid DNA was purchased from OriGene (Rockville, MD, USA). pCMV6-empty vector was used as a control. pCMV-Neo-Bam p53 R175H (R175H), pCMV-Neo-Bam p53 R248W (R248W), and pCMV-Neo-Bam (Empty) were purchased from Addgene ( a gift from Bert Vogelstein, addgene, #16436; http://n2t.net/addgene:16436 ; RRID:Addgene_16436, #16437; http://n2t.net/addgene:16437 ; RRID:Addgene_16437, #16440; http://n2t.net/addgene:16440 ; RRID:Addgene_16440, respectively).

Techniques: Recombinant, Transfection, DNA Extraction, CCK-8 Assay, SYBR Green Assay, Plasmid Preparation, Amplification, Extraction, Bradford Protein Assay, Microarray, RNA Sequencing, Negative Control, Expressing, Sequencing, Software, CRISPR

Journal: Communications Biology

Article Title: ANKLE1 cleaves mitochondrial DNA and contributes to cancer risk by promoting apoptosis resistance and metabolic dysregulation

doi: 10.1038/s42003-023-04611-w

Figure Lengend Snippet: a Confocal microscopy images (scale bar = 10 μm) of MCF10A-5E cells overexpressing GFP-ANKLE1, N_terminal_COX8-CFP, and RFP-LC3 proteins shows colocalization of ANKLE1, mitochondria, and autophagasomes. b We quantified relative levels of ANKLE1 mRNA and mtDNA over a 22 day time course of transient ANKLE1 expression. Although ANKLE1 levels return to baseline (Fig. ), the decrease of mtDNA level is maintained. c , d We used the Seahorse XF Real-Time ATP Rate Assay to show that ANKLE1 decreases the fraction of ATP produced by mitochondria ( c ) and ANKLE1 increases maximum compensatory glycolysis in MCF10A-5E ( d ). e Flow cytometry analysis quantification of Figure shows that ANKLE1 induces apoptosis in MCF10A-5E cells and apoptosis is abolished by a TP53 dominant negative mutant. f The level of ANKLE1 mRNA in human noTNBC and TNBC samples isolated from TP53 wild-type or mutant tumors indicates higher expression when TP53 is mutated. g , h ANKLE1 overexpression produced more colonies when MCF10A-5E cells were treated with anti-FAS activating antibodies, even though ANKLE1 transient expression occurred 11 days prior to anti-FAS treatment ( p -values are calculated with a two-tailed t-test).

Article Snippet: TP53DN(R175H)-CFP was constructed by cloning CFP from mitoCFP plasmid into AgeI site of p53 (dominant negative R175H mutant)-pcw107-V5 (Addgene Plasmid #64638 ), using 5′- GGGTTAGGGATAGGCTTACCACCGGTTTACTTGTACAGCTCGTCCATGC - 5′ and 5′- CTTGTACAAAGTGGTTACCGGAGGATCCGGTGGTGTGAGCAAGGGCGAGGAGCTG - 5′ primers for PCR and In-Fusion Cloning (Takara Bio).

Techniques: Confocal Microscopy, Expressing, Produced, Flow Cytometry, Dominant Negative Mutation, Isolation, Mutagenesis, Over Expression, Two Tailed Test

Journal: iScience

Article Title: Tumor-suppressive role of the musculoaponeurotic fibrosarcoma gene in colorectal cancer

doi: 10.1016/j.isci.2023.106478

Figure Lengend Snippet: Inverse relationship between c-MAF and p53 protein expression

Article Snippet: . pCMV6-c-MAF plasmid DNA was purchased from OriGene (Rockville, MD, USA). pCMV6-empty vector was used as a control. pCMV-Neo-Bam p53 R175H (R175H), pCMV-Neo-Bam p53 R248W (R248W), and pCMV-Neo-Bam (Empty) were purchased from Addgene ( a gift from Bert Vogelstein, addgene, #16436; http://n2t.net/addgene:16436 ; RRID:Addgene_16436, #16437; http://n2t.net/addgene:16437 ; RRID:Addgene_16437, #16440; http://n2t.net/addgene:16440 ; RRID:Addgene_16440, respectively).

Techniques: Expressing

Journal: iScience

Article Title: Tumor-suppressive role of the musculoaponeurotic fibrosarcoma gene in colorectal cancer

doi: 10.1016/j.isci.2023.106478

Figure Lengend Snippet: Key resources table

Article Snippet: . pCMV6-c-MAF plasmid DNA was purchased from OriGene (Rockville, MD, USA). pCMV6-empty vector was used as a control. pCMV-Neo-Bam p53 R175H (R175H), pCMV-Neo-Bam p53 R248W (R248W), and pCMV-Neo-Bam (Empty) were purchased from Addgene ( a gift from Bert Vogelstein, addgene, #16436; http://n2t.net/addgene:16436 ; RRID:Addgene_16436, #16437; http://n2t.net/addgene:16437 ; RRID:Addgene_16437, #16440; http://n2t.net/addgene:16440 ; RRID:Addgene_16440, respectively).

Techniques: Recombinant, Transfection, DNA Extraction, CCK-8 Assay, SYBR Green Assay, Plasmid Preparation, Amplification, Extraction, Bradford Protein Assay, Microarray, RNA Sequencing, Negative Control, Expressing, Sequencing, Software, CRISPR